Variant #0000569881 (NC_000020.10:g.4680094_4680117del, PRNP(NM_000311.3):c.228_251del)

Chromosome 20
Allele Unknown
Affects function (as reported) Does not affect function
Affects function (by curator) Not classified
Classification method -
Clinical classification benign
DNA change (genomic) (Relative to hg19 / GRCh37) g.4680094_4680117del
DNA change (hg38) g.4699448_4699471del
Published as PRNP(NM_000311.4):c.228_251delCCATGGTGGTGGCTGGGGACAGCC (p.P84_Q91del)
DB-ID PRNP_000061
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Segregation -
Frequency -
Re-site -
Methylation -
Average frequency (gnomAD v.2.1.1) Variant not found in online data sets
Owner VKGL-NL_VUmc
Database submission license Creative Commons Attribution-NonCommercial-ShareAlike 4.0 InternationalCreative Commons License
Created by VKGL-NL_VUmc

Variant on transcripts



Affects function     


DNA change (cDNA)     

RNA change     


PRNP NM_000311.3 -/. - c.228_251del r.(?) p.(Pro84_Gln91del) -