Genomic variant #0000575475

Chromosome X
Allele Unknown
Affects function (as reported) Effect unknown
Affects function (by curator) Not classified
Classification method -
Clinical classification VUS
DNA change (genomic) (Relative to hg19 / GRCh37) g.2867554_2867574dup
DNA change (hg38) -
Published as ARSE(NM_001282628.1):c.707_727dupTGGTAGCAGGGAAGCTCACAC (p.L236_T242dup)
DB-ID ARSE_000085
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Segregation -
Frequency -
Re-site -
Methylation -
Average frequency (large NGS studies) Variant not found in online data sets
Owner VKGL-NL_Groningen

Variant on transcripts



Affects function     


DNA change (cDNA)     

RNA change     

ARSE NM_000047.2 ?/. - c.632_652dup r.(?) p.(Leu211_Thr217dup)