Variant #0000577290 (NC_000023.10:g.70586193_70586217dup, NM_004606.3:c.29_53dup (TAF1))
| Chromosome |
X |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.70586193_70586217dup |
| DNA change (hg38) |
g.71366343_71366367dup |
| Published as |
TAF1(NM_001286074.1):c.29_53dupGGACAGCAGCTACCATCACTGCTGC (p.A19Dfs*50) |
| ISCN |
- |
| DB-ID |
TAF1_000060 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Rotterdam |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Rotterdam |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2020-07-20 14:55:05 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|