Variant #0000595726 (NC_000017.10:g.76129516_76129538del, NM_152468.4:c.561_583del (TMC8))
| Individual ID |
00264028 |
| Chromosome |
17 |
| Allele |
Both (homozygous) |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic (recessive) |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.76129516_76129538del |
| DNA change (hg38) |
g.78133435_78133457del |
| Published as |
561_583delTGCGTACCGAGTGGGGCCGGAGA |
| ISCN |
- |
| DB-ID |
TMC8_000026 |
| Variant remarks |
- |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
2.0E-5 View details |
| Owner |
Amir Hossein Saeidian |
| Database submission license |
No license selected |
| Created by |
Amir Hossein Saeidian |
| Date created |
2019-09-05 22:24:17 +02:00 (CEST) |
| Date last edited |
2019-09-16 22:28:31 +02:00 (CEST) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|