Variant #0000604276 (NC_000009.11:g.135804396del, NC_000009.11(NM_000368.4):c.-80-51del (TSC1))
| Chromosome |
9 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Effect unknown |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.135804396del |
| DNA change (hg38) |
g.132929009del |
| Published as |
- |
| ISCN |
- |
| DB-ID |
TSC1_000608 See all 2 reported entries |
| Variant remarks |
5'UTR variant; 1bp deletion of T; deleted base is in bracket and CAPITAL - cttgcaggtattttctttttt(T)atggagaaaaatggggccatttag |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
SUMMARY record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Rosemary Ekong |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Rosemary Ekong |
| Date created |
2019-11-21 19:44:36 +01:00 (CET) |
| Date last edited |
2020-11-02 09:56:34 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|