Variant #0000611955 (NC_000009.11:g.136419687_136419716del, NM_001145320.1:c.1148_1177del (ADAMTSL2))
Chromosome |
9 |
Allele |
Unknown |
Affects function (as reported) |
Probably does not affect function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
likely benign |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.136419687_136419716del |
DNA change (hg38) |
g.133554565_133554594del |
Published as |
ADAMTSL2(NM_001145320.1):c.1148_1177delACCGGCTGTTCGGCCACCCGGGCCTGGACA (p.N383_D392del), ADAMTSL2(NM_014694.4):c.1148_1177del (p.(Asn383_Asp392del))... |
ISCN |
- |
DB-ID |
ADAMTSL2_000015 See all 4 reported entries |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Rotterdam |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Rotterdam |
Date created |
2019-12-04 15:24:38 +01:00 (CET) |
Date last edited |
2025-05-05 21:14:00 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|