Genomic variant #0000614459

Chromosome 13
Allele Unknown
Affects function (as reported) Effect unknown
Affects function (by curator) Not classified
DNA change (genomic) (Relative to hg19 / GRCh37) g.100637714_100637743del
DNA change (hg38) -
Published as ZIC2(NM_007129.4):c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC (p.A461_A470del)
DB-ID ZIC2_000043
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Segregation -
Frequency -
Re-site -
Methylation -
Average frequency (large NGS studies) Variant not found in online data sets

Variant on transcripts



Affects function     


DNA change (cDNA)     


RNA change     


ZIC2 NM_007129.3 ?/. - c.1377_1406del VUS r.(?) p.(Ala461_Ala470del) -