Variant #0000619059 (NC_000023.10:g.139586494_139586514del, NM_005634.2:c.717_737del (SOX3))
| Chromosome |
X |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.139586494_139586514del |
| DNA change (hg38) |
g.140504329_140504349del |
| Published as |
SOX3(NM_005634.2):c.717_737delCGCTGCCGCGGCCGCAGCCGC (p.A242_A248del), SOX3(NM_005634.3):c.717_737delCGCTGCCGCGGCCGCAGCCGC (p.A242_A248del) |
| ISCN |
- |
| DB-ID |
SOX3_000012 See all 3 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
0.00066 View details |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2019-12-04 15:24:38 +01:00 (CET) |
| Date last edited |
2023-01-11 15:44:22 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|