Variant #0000619425 (NC_000023.10:g.24329160_24329183del, NM_001136233.1:c.2259_2282del (SUPT20HL2))
| Chromosome |
X |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.24329160_24329183del |
| DNA change (hg38) |
g.24311043_24311066del |
| Published as |
SUPT20HL2(NM_001136233.2):c.2337_2360delGCCGCTGCTGCTGCTGCAGCCACA (p.L781_P788del) |
| ISCN |
- |
| DB-ID |
SUPT20HL2_000033 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Rotterdam |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Rotterdam |
| Date created |
2019-12-04 15:24:38 +01:00 (CET) |
| Date last edited |
2020-03-23 16:13:27 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|