Variant #0000620387 (NC_000001.10:g.150526234_150526253del, NM_019032.4:c.767_786del (ADAMTSL4))
Chromosome |
1 |
Allele |
Unknown |
Affects function (as reported) |
Affects function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
pathogenic |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.150526234_150526253del |
DNA change (hg38) |
g.150553758_150553777del |
Published as |
ADAMTSL4(NM_001288608.1):c.767_786delAGGCCTCTGGCACAGAGCCC (p.Q256Pfs*38), ADAMTSL4(NM_019032.6):c.767_786delAGGCCTCTGGCACAGAGCCC (p.Q256Pfs*38) |
ISCN |
- |
DB-ID |
ADAMTSL4_000001 See all 16 reported entries |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Rotterdam |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Rotterdam |
Date created |
2019-12-06 12:43:26 +01:00 (CET) |
Date last edited |
2023-01-11 15:44:22 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|