Variant #0000621001 (NC_000002.11:g.240913010_240913030del, NC_000002.11(NM_004544.3):c.1000-12385_1000-12365del (NDUFA10))
| Chromosome |
2 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.240913010_240913030del |
| DNA change (hg38) |
g.239973593_239973613del |
| Published as |
NDUFA10(NM_001322019.1):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_R370del), NDUFA10(NM_001322019.2):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_...) |
| ISCN |
- |
| DB-ID |
NDUFA10_000014 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2019-12-06 12:43:26 +01:00 (CET) |
| Date last edited |
2021-09-17 14:40:49 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|