Variant #0000621907 (NC_000007.13:g.5567666_5567692del, ACTB(NM_001101.3):c.931_957del)

Chromosome 7
Allele Unknown
Affects function (as reported) Probably affects function
Affects function (by curator) Not classified
Classification method -
Clinical classification likely pathogenic
DNA change (genomic) (Relative to hg19 / GRCh37) g.5567666_5567692del
DNA change (hg38) g.5528035_5528061del
Published as ACTB(NM_001101.3):c.931_957delGACAGGATGCAGAAGGAGATCACTGCC (p.D311_A319del)
ISCN -
DB-ID ACTB_000059
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Origin CLASSIFICATION record
Segregation -
Frequency -
Re-site -
VIP -
Methylation -
Average frequency (gnomAD v.2.1.1) Variant not found in online data sets
Owner VKGL-NL_VUmc
Database submission license No license selected
Created by VKGL-NL_VUmc
Options




Variant on transcripts


Gene     

AscendingTranscript     

Affects function     

Exon     

DNA change (cDNA)     

RNA change     

Protein     
ACTB NM_001101.3 +?/. - c.931_957del r.(?) p.(Asp311_Ala319del)