Variant #0000624067 (NC_000019.9:g.50832287_50832308dup, NM_004977.2:c.34_55dup (KCNC3))
| Chromosome |
19 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.50832287_50832308dup |
| DNA change (hg38) |
g.50329030_50329051dup |
| Published as |
KCNC3(NM_004977.2):c.34_55dupGGGCGCCAGGGGGCCAGCAAGC (p.Q19Rfs*89) |
| ISCN |
- |
| DB-ID |
KCNC3_000039 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_AMC |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_AMC |
| Date created |
2019-12-06 12:43:26 +01:00 (CET) |
| Date last edited |
2020-07-16 11:09:09 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|