Variant #0000629918 (NC_000016.9:g.2137969_2138002del, NC_000016.9(NM_000548.3):c.5068+27_5069-47del (TSC2))
| Chromosome |
16 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Does not affect function |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.2137969_2138002del |
| DNA change (hg38) |
g.2087968_2088001del |
| Published as |
- |
| ISCN |
- |
| DB-ID |
TSC2_000144 See all 30 reported entries |
| Variant remarks |
34bp intronic deletion [caggaaaggtagggccgggtggggccctgcagtg] causes abnormal splicing and the retention of 72bp from intron 39, resulting in the in-frame insertion of 24 new amino acids; variant seen in affected and unaffected individuals |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
rs137854209 |
| Origin |
SUMMARY record |
| Segregation |
- |
| Frequency |
593/285634 alleles, 1 homozygote |
| Re-site |
BsgI- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Rosemary Ekong |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Rosemary Ekong |
| Date created |
2020-01-02 10:22:42 +01:00 (CET) |
| Date last edited |
2021-08-18 14:47:59 +02:00 (CEST) |

Variant on transcripts
|