Variant #0000634349 (NC_000016.9:g.2137969_2138002del, NC_000016.9(NM_000548.3):c.5068+27_5069-47del (TSC2))
| Individual ID |
00278027 |
| Chromosome |
16 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.2137969_2138002del |
| DNA change (hg38) |
g.2087968_2088001del |
| Published as |
c.5051_5068+16del34 [CCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG] |
| ISCN |
- |
| DB-ID |
TSC2_000144 See all 30 reported entries |
| Variant remarks |
34bp deletion [caggaaaggtagggccgggtggggccctgcagtg] reported as non-pathogenic; affects splicing; deleted allele produces less TSC2 mRNA compared to wild type; variant proposed to have modifier effect on severity of TSC |
| Reference |
PubMed: Roberts, 2003 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
-BsgI |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Rosemary Ekong |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Rosemary Ekong |
| Date created |
2006-03-29 14:05:00 +02:00 (CEST) |
| Date last edited |
2021-04-23 13:58:39 +02:00 (CEST) |

Variant on transcripts
Screenings
|