Variant #0000645313 (NC_000020.10:g.4680093_4680094ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]], PRNP(NM_000311.3):c.227_228ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]])

Individual ID 00288215
Chromosome 20
Allele Unknown
Affects function (as reported) Affects function
Affects function (by curator) Not classified
Classification method -
Clinical classification pathogenic
DNA change (genomic) (Relative to hg19 / GRCh37) g.4680093_4680094ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]]
DNA change (hg38) g.4699447_4699448ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]]
Published as -
ISCN -
DB-ID PRNP_000064
Variant remarks -
Reference PubMed: Lee 2019
ClinVar ID ClinVar-000992388.1
dbSNP ID -
Origin Germline/De novo (untested)
Segregation -
Frequency -
Re-site -
VIP 0
Methylation -
Average frequency (gnomAD v.2.1.1) Variant not found in online data sets
Owner Johan den Dunnen
Database submission license Creative Commons Attribution-NonCommercial-ShareAlike 4.0 InternationalCreative Commons License
Created by Johan den Dunnen
Options




Variant on transcripts


Gene     

AscendingTranscript     

Affects function     

Exon     

DNA change (cDNA)     

RNA change     

Protein     

Haplotype     
PRNP NM_000311.3 +/. - c.227_228ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] r.227_228ins[ucauggugguggcugggggcagcc[2];ccauggugguggcuggggacagcc;ucauggugguggcugggggcagcc[5]] p.(Gln91_Gly92insProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGln) -



Screenings


AscendingScreening ID     

Template     

Technique     

Tissue     

Remarks     

Genes screened     

Variants found     

Owner     
0000289384 DNA;RNA RT-PCR;SEQ;SEQ-NG blood WES PRNP 1 Johan den Dunnen