Variant #0000645313 (NC_000020.10:g.4680093_4680094ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]], NM_000311.3:c.227_228ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] (PRNP))
| Individual ID |
00288215 |
| Chromosome |
20 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.4680093_4680094ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] |
| DNA change (hg38) |
g.4699447_4699448ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] |
| Published as |
- |
| ISCN |
- |
| DB-ID |
PRNP_000064 |
| Variant remarks |
- |
| Reference |
PubMed: Lee 2019 |
| ClinVar ID |
ClinVar-000992388.1 |
| dbSNP ID |
- |
| Origin |
Germline/De novo (untested) |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2020-02-16 14:03:09 +01:00 (CET) |
| Date last edited |
2021-03-17 14:24:32 +01:00 (CET) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|