Variant #0000655495 (NC_000006.11:g.139694521_139694544del, NM_001168388.2:c.547_570del (CITED2))
| Chromosome |
6 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.139694521_139694544del |
| DNA change (hg38) |
g.139373384_139373407del |
| Published as |
CITED2(NM_006079.4):c.547_570delTCGGGCGGCGGCGCGGGCAGCAGC (p.(Ser183_Ser190del)), CITED2(NM_006079.4):c.547_570delTCGGGCGGCGGCGCGGGCAGCAGC (p.S183_...) |
| ISCN |
- |
| DB-ID |
CITED2_000002 See all 3 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2020-03-23 16:13:27 +01:00 (CET) |
| Date last edited |
2024-08-28 13:16:32 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|