Variant #0000655992 (NC_000008.10:g.12956899_12956919dup, NM_182643.2:c.2927_2947dup (DLC1))
| Chromosome |
8 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.12956899_12956919dup |
| DNA change (hg38) |
g.13099390_13099410dup |
| Published as |
DLC1(NM_182643.3):c.2927_2947dupAGCCCTCCGAGATCCCGGAAA (p.E982_R983ins7) |
| ISCN |
- |
| DB-ID |
DLC1_000010 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2020-03-23 16:13:27 +01:00 (CET) |
| Date last edited |
2021-09-17 14:40:49 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|