Variant #0000678272 (NC_000008.10:g.11565869_11565892del, NM_002052.3:c.48_71del (GATA4))
| Chromosome |
8 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.11565869_11565892del |
| DNA change (hg38) |
- |
| Published as |
GATA4(NM_002052.3):c.42_65del (p.(Tyr18_Ala25del)), GATA4(NM_002052.5):c.48_71delTGCCTACGAGGCGGGCGGCCCCGG (p.Y18_A25del) |
| ISCN |
- |
| DB-ID |
GATA4_000095 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2020-08-06 14:59:34 +02:00 (CEST) |
| Date last edited |
2022-05-09 15:51:19 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|