Variant #0000678645 (NC_000009.11:g.2039797_2039817del, SMARCA2(NM_003070.3):c.687_707del)

Chromosome 9
Allele Unknown
Affects function (as reported) Effect unknown
Affects function (by curator) Not classified
Classification method -
Clinical classification VUS
DNA change (genomic) (Relative to hg19 / GRCh37) g.2039797_2039817del
DNA change (hg38) -
Published as SMARCA2(NM_003070.4):c.687_707delGCAGCAGCAGCAGCAGCAGCA (p.Q232_Q238del)
ISCN -
DB-ID SMARCA2_000154
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Origin CLASSIFICATION record
Segregation -
Frequency -
Re-site -
VIP -
Methylation -
Average frequency (gnomAD v.2.1.1) Variant not found in online data sets
Owner VKGL-NL_Rotterdam
Options




Variant on transcripts


Gene     

AscendingTranscript     

Affects function     

Exon     

DNA change (cDNA)     

RNA change     

Protein     
SMARCA2 NM_003070.3 ?/. - c.687_707del r.(?) p.(Gln232_Gln238del)