Variant #0000678768 (NC_000010.10:g.112404353_112404373del, NM_001134363.1:c.141_161del (RBM20))
| Chromosome |
10 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.112404353_112404373del |
| DNA change (hg38) |
- |
| Published as |
RBM20(NM_001134363.1):c.141_161delGCCCCAGCCACCGCCCCCGCC (p.P48_P54del) |
| ISCN |
- |
| DB-ID |
RBM20_000275 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Utrecht |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Utrecht |
| Date created |
2020-08-06 14:59:34 +02:00 (CEST) |
| Date last edited |
2020-09-15 15:50:26 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|