Variant #0000681600 (NC_000020.10:g.34025175_34025194dup, NM_000557.2:c.517_536dup (GDF5))
Chromosome |
20 |
Allele |
Unknown |
Affects function (as reported) |
Affects function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
pathogenic |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.34025175_34025194dup |
DNA change (hg38) |
- |
Published as |
GDF5(NM_000557.4):c.517_536dupATGCTCTCGCTGTACAGGAC (p.L180Cfs*20), GDF5(NM_000557.5):c.517_536dupATGCTCTCGCTGTACAGGAC (p.L180Cfs*20) |
ISCN |
- |
DB-ID |
GDF5_000026 See all 2 reported entries |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Rotterdam |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Rotterdam |
Date created |
2020-08-06 14:59:34 +02:00 (CEST) |
Date last edited |
2023-11-27 17:27:23 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|