Variant #0000689685 (NC_000006.11:g.170871055_170871082del, NM_001172085.1:c.171_198del (TBP))
| Chromosome |
6 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.170871055_170871082del |
| DNA change (hg38) |
- |
| Published as |
TBP(NM_003194.4):c.231_258delGCAGCAGCAGCAGCAGCAGCAGCAGCAG (p.Q77Hfs*58), TBP(NM_003194.5):c.231_258del (p.(Gln77HisfsTer58)) |
| ISCN |
- |
| DB-ID |
TBP_000041 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Rotterdam |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Rotterdam |
| Date created |
2020-09-15 15:50:26 +02:00 (CEST) |
| Date last edited |
2024-04-19 20:27:30 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|