Variant #0000690345 (NC_000009.11:g.103348380_103348400del, NM_001018116.1:c.742_762del (MURC))
| Chromosome |
9 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.103348380_103348400del |
| DNA change (hg38) |
- |
| Published as |
CAVIN4(NM_001018116.2):c.742_762delCTGAGACAGTCAGGGGAGAGG (p.L248_R254del) |
| ISCN |
- |
| DB-ID |
MURC_000003 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2020-09-15 15:50:26 +02:00 (CEST) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|