Variant #0000693134 (NC_000022.10:g.28194933_28194953del, NM_002430.2:c.1605_1625del (MN1))
| Chromosome |
22 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.28194933_28194953del |
| DNA change (hg38) |
- |
| Published as |
MN1(NM_002430.2):c.1605_1625delGCAGCAGCAGCAGCAACAGCA (p.Q544_Q550del), MN1(NM_002430.3):c.1605_1625delGCAGCAGCAGCAGCAACAGCA (p.Q544_Q550del) |
| ISCN |
- |
| DB-ID |
MN1_000028 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Rotterdam |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Rotterdam |
| Date created |
2020-09-15 15:50:26 +02:00 (CEST) |
| Date last edited |
2022-05-09 15:24:52 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|