Variant #0000719285 (NC_000003.11:g.181430218_181430237del, NM_003106.3:c.70_89del (SOX2))
| Chromosome |
3 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.181430218_181430237del |
| DNA change (hg38) |
- |
| Published as |
SOX2(NM_003106.4):c.70_89delAACTCCACCGCGGCGGCGGC (p.N24Rfs*65) |
| ISCN |
- |
| DB-ID |
SOX2_000006 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_VUmc |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_VUmc |
| Date created |
2021-02-08 18:36:18 +01:00 (CET) |
| Date last edited |
2023-01-11 15:44:22 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|