Variant #0000723592 (NC_000011.9:g.65838061_65838081dup, NM_018026.3:c.104_124dup (PACS1))
| Chromosome |
11 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.65838061_65838081dup |
| DNA change (hg38) |
- |
| Published as |
PACS1(NM_018026.4):c.104_124dupAGCAGCAGCAGCAGCAGCCGC (p.Q35_P41dup) |
| ISCN |
- |
| DB-ID |
PACS1_000022 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2021-02-08 18:36:18 +01:00 (CET) |
| Date last edited |
2021-09-17 14:40:49 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|