Variant #0000724906 (NC_000014.8:g.89077301_89077325del, NC_000014.8(NM_024824.4):c.2204+17_2204+41del (ZC3H14))
Chromosome |
14 |
Allele |
Unknown |
Affects function (as reported) |
Does not affect function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
benign |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.89077301_89077325del |
DNA change (hg38) |
- |
Published as |
ZC3H14(NM_024824.5):c.2204+17_2204+41delGTTTTTCTCATGTCAGTTCAAATTC |
ISCN |
- |
DB-ID |
EML5_000007 See all 2 reported entries |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Groningen |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Groningen |
Date created |
2021-02-08 18:36:18 +01:00 (CET) |
Date last edited |
2021-09-17 14:40:49 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|