Variant #0000728389 (NC_000023.10:g.12516876_12516898del, FRMPD4(NM_014728.3):c.119_141del)

Chromosome X
Allele Unknown
Affects function (as reported) Probably affects function
Affects function (by curator) Not classified
Classification method -
Clinical classification likely pathogenic
DNA change (genomic) (Relative to hg19 / GRCh37) g.12516876_12516898del
DNA change (hg38) -
Published as FRMPD4(NM_014728.3):c.119_141delAGATGACGGCAAACCGAGATGGG (p.E40Afs*15)
ISCN -
DB-ID FRMPD4_000052
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Origin CLASSIFICATION record
Segregation -
Frequency -
Re-site -
VIP -
Methylation -
Average frequency (gnomAD v.2.1.1) Variant not found in online data sets
Owner VKGL-NL_VUmc
Database submission license Creative Commons Attribution-NonCommercial-ShareAlike 4.0 InternationalCreative Commons License
Created by VKGL-NL_VUmc
Options




Variant on transcripts


Gene     

AscendingTranscript     

Affects function     

Exon     

DNA change (cDNA)     

RNA change     

Protein     
FRMPD4 NM_014728.3 +?/. - c.119_141del r.(?) p.(Glu40AlafsTer15)