Variant #0000760776 (NC_000006.11:g.43014781_43014803del, NM_014780.4:c.2212_2234del (CUL7))
| Individual ID |
00359472 |
| Chromosome |
6 |
| Allele |
Both (homozygous) |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic (recessive) |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.43014781_43014803del |
| DNA change (hg38) |
g.43047043_43047065del |
| Published as |
2212_2235delTGAGCAGGGACTATGCCGTGGTG |
| ISCN |
- |
| DB-ID |
CUL7_000073 |
| Variant remarks |
- |
| Reference |
PubMed: Huber 2005 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2021-03-22 14:23:02 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|