Variant #0000764759 (NC_000011.9:g.118895988_118896007del, NM_001164277.1:c.1019_1038del (SLC37A4))
| Individual ID |
00362742 |
| Chromosome |
11 |
| Allele |
Parent #2 |
| Affects function (as reported) |
Probably affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely pathogenic (recessive) |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.118895988_118896007del |
| DNA change (hg38) |
g.119025278_119025297del |
| Published as |
1019_1038delTCTCCTCGTATGGCCCCATT |
| ISCN |
- |
| DB-ID |
SLC37A4_000070 |
| Variant remarks |
- |
| Reference |
PubMed: Tsangaris 2011 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2021-04-23 13:33:15 +02:00 (CEST) |
| Date last edited |
N/A |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|