Variant #0000771773 (NC_000001.10:g.94512522_94512542del, NM_000350.2:c.2857_2877del (ABCA4))
Individual ID |
00369587 |
Chromosome |
1 |
Allele |
Unknown |
Affects function (as reported) |
Probably affects function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
likely pathogenic (recessive) |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.94512522_94512542del |
DNA change (hg38) |
g.94046966_94046986del |
Published as |
c.2857_2877delTTCTACGAGAACCAGATCACC p.(Phe953_Thr959del) |
ISCN |
- |
DB-ID |
ABCA4_001113 See all 5 reported entries |
Variant remarks |
no variant 2nd chromosome |
Reference |
PubMed: Koyanagi 2019 |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
Unknown |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
Stéphanie Cornelis |
Database submission license |
Creative Commons Attribution 4.0 International |
Created by |
Stéphanie Cornelis |
Date created |
2021-05-03 14:25:36 +02:00 (CEST) |
Date last edited |
N/A |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|