Variant #0000782304 (NC_000016.9:g.2098091_2098111del, NC_000016.9(NM_000548.3):c.-30+25_-30+45del (TSC2))
| Chromosome |
16 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Does not affect function |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.2098091_2098111del |
| DNA change (hg38) |
g.2048090_2048110del |
| Published as |
- |
| ISCN |
- |
| DB-ID |
TSC2_003385 See all 4 reported entries |
| Variant remarks |
one 21bp tandem-repeat element (agtggcggtccccacggggca) deleted in intron 1; 24bp from end of exon 1 |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
rs796053514 |
| Origin |
SUMMARY record |
| Segregation |
- |
| Frequency |
178/36264 alleles, 3 homozygotes |
| Re-site |
BsmFI-, XcmI- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Rosemary Ekong |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Rosemary Ekong |
| Date created |
2021-05-04 16:22:13 +02:00 (CEST) |
| Date last edited |
N/A |

Variant on transcripts
|