Variant #0000782304 (NC_000016.9:g.2098091_2098111del, NC_000016.9(NM_000548.3):c.-30+25_-30+45del (TSC2))
Chromosome |
16 |
Allele |
Unknown |
Affects function (as reported) |
Does not affect function |
Affects function (by curator) |
Does not affect function |
Classification method |
- |
Clinical classification |
benign |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.2098091_2098111del |
DNA change (hg38) |
g.2048090_2048110del |
Published as |
- |
ISCN |
- |
DB-ID |
TSC2_003385 See all 4 reported entries |
Variant remarks |
one 21bp tandem-repeat element (agtggcggtccccacggggca) deleted in intron 1; 24bp from end of exon 1 |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
rs796053514 |
Origin |
SUMMARY record |
Segregation |
- |
Frequency |
178/36264 alleles, 3 homozygotes |
Re-site |
BsmFI-, XcmI- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
Rosemary Ekong |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
Rosemary Ekong |
Date created |
2021-05-04 16:22:13 +02:00 (CEST) |
Date last edited |
N/A |

Variant on transcripts
|