Variant #0000784857 (NC_000011.9:g.75277732_75277751delinsTGCAACGTGACCCACGCACGTG, NM_001207014.1:c.338_357delinsTGCAACGTGACCCACGCACGTG (SERPINH1))
| Individual ID |
00372906 |
| Chromosome |
11 |
| Allele |
Both (homozygous) |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Affects function |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.75277732_75277751delinsTGCAACGTGACCCACGCACGTG |
| DNA change (hg38) |
- |
| Published as |
- |
| ISCN |
- |
| DB-ID |
SERPINH1_000009 |
| Variant remarks |
The inserted bases were later confirmed by the authors to be:; TGCAACGTGACCCACGCACGTG |
| Reference |
PubMed: Marshall 2016 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Raymond Dalgleish |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Raymond Dalgleish |
| Date created |
2016-10-21 09:17:43 +02:00 (CEST) |
| Date last edited |
2016-10-21 09:18:26 +02:00 (CEST) |

Variant on transcripts
Screenings
|