Variant #0000802404 (NC_000006.11:g.157099432_157099455dup, NM_020732.3:c.369_392dup (ARID1B))
| Chromosome |
6 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.157099432_157099455dup |
| DNA change (hg38) |
- |
| Published as |
ARID1B(NM_001346813.1):c.369_392dupGCAGCAGCAGCAGCAGCAACAGCA (p.Q124_Q131dup) |
| ISCN |
- |
| DB-ID |
ARID1B_000125 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Rotterdam |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Rotterdam |
| Date created |
2021-09-17 14:40:49 +02:00 (CEST) |
| Date last edited |
2024-04-19 20:27:30 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|