Variant #0000814872 (NC_000011.9:g.86662746_86662766del, NM_012193.3:c.1034_1054delCTTATTTCCACATTGCAGCCT (FZD4))

Individual ID	00385791
Chromosome	11
Allele	Parent #1
Affects function (as reported)	Probably affects function
Affects function (by curator)	Not classified
Classification method	-
Clinical classification	likely pathogenic
DNA change (genomic) (Relative to hg19 / GRCh37)	g.86662746_86662766del
DNA change (hg38)	g.86951704_86951724del
Published as	1034_1054delCTTATTTCCACATTGCAGCCT, Ser345Trpfs
ISCN	-
DB-ID	FZD4_000067 See all 2 reported entries
Variant remarks	error in annotation: c.1034_1054del is an in-frame and not a frameshift deletion causing p.(Ser345_Ala351del) and not p.(Ser345fs)
Reference	PubMed: Chen 2020
ClinVar ID	-
dbSNP ID	-
Origin	Germline
Segregation	yes
Frequency	-
Re-site	-
VIP	-
Methylation	-
Average frequency (gnomAD v.2.1.1)	Retrieve
Owner	LOVD
Database submission license
Created by	Anna Tracewska
Date created	2021-10-15 13:34:46 +02:00 (CEST)
Date last edited	2021-10-15 13:35:26 +02:00 (CEST)

View location in UCSC genome browser
View location in Ensembl genome browser
View variant in MobiDetails

Variant on transcripts

Legend

Please note that a short description of a certain column can be displayed when you move your mouse cursor over the column's header and hold it still. Below, a more detailed description is shown per column.

Affects function: The variant's effect on the function of the gene/protein, displayed in the format 'R/C'. R is the value reported by the source (publication, submitter) and this classification may vary between records. C is the value concluded by the curator. Note that in some database the curator uses Summary records to give details on the classification of the variant.Values used: '+' indicating the variant affects function, '+?' probably affects function, '-' does not affect function, '-?' probably does not affect function, '?' effect unknown, '.' effect was not classified.

Exon: number of exon/intron containing variant; 2 = exon 2, 12i = intron 12, 2i_7i = from intron 2 to intron 7, 8i_9 = intron 8/exon 9 boundary, _1 = 5' to exon 1, 18_ = 3' of exon 18, _1_18_ = encompassing the entire 18-exon gene

DNA change (cDNA): description of variant at DNA level, based on a coding DNA reference sequence (following HGVS recommendations); e.g. c.123C>T, c.123_145del, c.123_126dup. For deletions/duplications extending beyond the reference transcript resp. {0}/{2} is used to replace del/dup. Extent of the deletion/duplication should be specified using the genomic description (g.). "-" indicates the variant described on genomic level does not affect the coding DNA reference sequence.

RNA change: description of variant at RNA level (following HGVS recommendations).

r.123c>u
r.? = unknown
r.(?) = RNA not analysed but probably transcribed copy of DNA variant
r.spl? = RNA not analysed but variant probably affects splicing
r.(spl?) = RNA not analysed but variant may affect splicing
r.0? = change expected to abolish transcription

Protein: description of variant at protein level (following HGVS recommendations).

p.(Arg345Pro) = change predicted from DNA (RNA not analysed)
p.Arg345Pro = change derived from RNA analysis
p.? = unknown effect
p.0? = probably no protein produced

How to query this table

All list views have search fields which can be used to search data. You can search for a complete word or you can search for a part of a search term. If you enclose two or more words in double quotes, LOVD will search for the combination of those words only exactly in the order you specify. Note that search terms are case-insensitive and that wildcards such as * are treated as normal text! For all options, like "and", "or", and "not" searches, or searching for prefixes or suffixes, see the table below.

Operator	Column type	Example	Matches
	Text	Arg	all entries containing 'Arg'
space	Text	Arg Ser	all entries containing 'Arg' and 'Ser'
\|	Text	Arg\|Ser	all entries containing 'Arg' or 'Ser'
!	Text	!fs	all entries not containing 'fs'
^	Text	^p.(Arg	all entries beginning with 'p.(Arg'
$	Text	Ser)$	all entries ending with 'Ser)'
=""	Text	=""	all entries with this field empty
=""	Text	="p.0"	all entries exactly matching 'p.0'
!=""	Text	!=""	all entries with this field not empty
!=""	Text	!="p.0"	all entries not exactly matching 'p.0?'
combination	Text	*\|Ter !fs	all entries containing '*' or 'Ter' but not containing 'fs'
	Date	2020	all entries matching the year 2020
\|	Date	2020-03\|2020-04	all entries matching March or April, 2020
!	Date	!2020-03	all entries not matching March, 2020
<	Date	<2020	all entries before the year 2020
<=	Date	<=2020-06	all entries in or before June, 2020
>	Date	>2020-06	all entries after June, 2020
>=	Date	>=2020-06-15	all entries on or after June 15th, 2020
combination	Date	2019\|2020 <2020-03	all entries in 2019 or 2020, and before March, 2020
	Numeric	23	all entries exactly matching 23
\|	Numeric	23\|24	all entries exactly matching 23 or 24
!	Numeric	!23	all entries not exactly matching 23
<	Numeric	<23	all entries lower than 23
<=	Numeric	<=23	all entries lower than, or equal to, 23
>	Numeric	>23	all entries higher than 23
>=	Numeric	>=23	all entries higher than, or equal to, 23
combination	Numeric	>=20 <30 !23	all entries with values from 20 to 29, but not equal to 23

Some more advanced examples:

Example	Matches
Asian	all entries containing 'Asian', 'asian', including 'Caucasian', 'caucasian', etc.
Asian !Caucasian	all entries containing 'Asian' but not containing 'Caucasian'
Asian\|African !Caucasian	all entries containing 'Asian' or 'African', but not containing 'Caucasian'
"South Asian"	all entries containing 'South Asian', but not containing 'South East Asian'

To sort on a certain column, click on the column header or on the arrows. If that column is already selected to sort on, the sort order will be swapped. The column currently sorted on has a darker blue background color than the other columns. The up and down arrows next to the column name indicate the current sorting direction. When sorting on any field other than the default, LOVD will sort secondarily on the default sort column.

Gene	Transcript	Affects function	Exon	DNA change (cDNA)	RNA change	Protein
FZD4	NM_012193.3	+?/.	-	c.1034_1054delCTTATTTCCACATTGCAGCCT	r.(?)	p.(Ser345_Ala351del)

Screenings

Legend

Please note that a short description of a certain column can be displayed when you move your mouse cursor over the column's header and hold it still. Below, a more detailed description is shown per column.

Template: Template(s) used to detect the sequence variant; DNA (genomic DNA), RNA (cDNA) or protein
All options:

DNA
RNA = RNA (cDNA)
protein
? = unknown

Technique: technique(s) used to identify the sequence variant.
All options:

? = unknown
ARMS = amplification refractory mutation system
arrayCGH = array for Comparative Genomic Hybridisation
arrayMET = array for methylation analysis
arraySEQ = array for resequencing
arraySNP = array for SNP typing
arrayCNV = array for Copy Number Variation (SNP and CNV probes)
ASO = allele-specific oligo hybridisation
BESS = Base Excision Sequence Scanning
CMC = Chemical Mismatch Cleavage
COBRA = Combined Bisulfite Restriction Analysis
CSCE = Conformation Sensitive Capillary Electrophoresis
CSGE = Conformation Sensitive Gel Electrophoresis
ddF = dideoxy Fingerprinting
DGGE = Denaturing-Gradient Gel-Electrophoresis
DHPLC = Denaturing High-Performance Liquid Chromatography
DOVAM = Detection Of Virtually All Mutations (SSCA variant)
DSCA = Double-Strand DNA Conformation Analysis
DSDI = Detection Small Deletions and Insertions
EMC = Enzymatic Mismatch Cleavage
expr = expression analysis
FISH = Fluorescent In-Situ Hybridisation
FISHf = fiberFISH
HD = HeteroDuplex analysis
HPLC = High-Performance Liquid Chromatography
IEF = IsoElectric Focussing
IHC = Immuno-Histo-Chemistry
Invader = Invader assay
MAPH = Multiplex Amplifiable Probe Hybridisation
MAQ = Multiplex Amplicon Quantification
MCA = Melting Curve Analysis, high-resolution (HRMA)
microscope = microscopic analysis (karyotype)
microsat = microsatellite genotyping
minigene = expression minigene construct
MIP = Molecular Inversion Probe amplification
MIPsm = single molecule Molecular Inversion Probe amplification
MLPA = Multiplex Ligation-dependent Probe Amplification
MLPA-ms = Multiplex Ligation-dependent Probe Amplification, methylation specific
MS = mass spectrometry
Northern = Northern blotting
NUC = nuclease digestion (RNAseT1, S1)
OM = optical mapping
PAGE = Poly-Acrylamide Gel-Electrophoresis
PCR = Polymerase Chain Reaction
PCRdd = PCR, digital droplet
PCRdig = PCR + restriction enzyme digestion
PCRh = PCR, haloplex
PCRlr = PCR, long-range
PCRm = PCR, multiplex
PCRms = PCR, methylation sensitive
PCRq = PCR, quantitative (qPCR)
PCRrp = PCR, repeat-primed (RP-PCR)
PCRsqd = PCR, semi-quantitative duplex
PE = primer extension (APEX, SNaPshot)
PEms = primer extension, methylation-sensitive single-nucleotide
PFGE = Pulsed-Field Gel-Electrophoresis (+Southern)
PTT = Protein Truncation Test
RFLP = Restriction Fragment Length Polymorphisms
RT-PCR = Reverse Transcription and PCR
RT-PCRq = Reverse Transcription and PCR, quantitative
SBE = Single Base Extension
SEQ = SEQuencing (Sanger)
SEQb = bisulfite SEQuencing
SEQp = pyroSequencing
SEQms = sequencing, methylation specific
SEQ-ON = next-generation sequencing - Oxford Nanopore
SEQ-NG = next-generation sequencing
SEQ-NG-RNA = next-generation sequencing RNA
SEQ-NG-H = next-generation sequencing - Helicos
SEQ-NG-I = next-generation sequencing - Illumina/Solexa
SEQ-NG-IT = next-generation sequencing - Ion Torrent
SEQ-NG-R = next-generation sequencing - Roche/454
SEQ-NG-S = next-generation sequencing - SOLiD
SEQ-PB = next-generation sequencing - Pacific Biosciences
SNPlex = SNPlex
Southern = Southern blotting
SSCA = Single-Strand DNA Conformation polymorphism Analysis (SSCP)
SSCAf = fluorescent SSCA (SSCP)
STR = Short Tandem Repeat
TaqMan = TaqMan assay
Western = Western blotting
- = not applicable

Tissue: tissue type used for analysis

Remarks: remarks regarding the screening like WGS (whole genome sequencing), WES (whole exome sequencing, gene panel (incl. a list of genes analysed), etc.

Screening ID	Template	Technique	Tissue	Remarks	Genes screened	Variants found	Owner
0000387019	DNA	SEQ-NG	blood	custom genetic pediatric retinal disease panel (Tang et al., 2017)	FZD4	1	LOVD

Global Variome shared LOVD

MIF (macrophage migration inhibitory factor (glyco...))