Variant #0000821524 (NC_000019.9:g.7532392_7532415del, NM_001130955.1:c.2738_2761del (ARHGEF18))
| Individual ID |
00390165 |
| Chromosome |
19 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.7532392_7532415del |
| DNA change (hg38) |
g.7467506_7467529del |
| Published as |
ARHGEF18 c.2738_2761delGGCTGGAGCAGGAGCGGGCCGAGC, p.Arg913_Glu920del |
| ISCN |
- |
| DB-ID |
ARHGEF18_000033 See all 2 reported entries |
| Variant remarks |
heterozygous, different transcript, NM_001130955.1: c.2738_2761delGGCTGGAGCAGGAGCGGGCCGAGC, p.Arg913_Glu920del |
| Reference |
PubMed: Turro 2020 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline/De novo (untested) |
| Segregation |
? |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
LOVD |
| Database submission license |
Creative Commons Attribution 4.0 International |
| Created by |
Anna Tracewska |
| Date created |
2021-11-10 12:02:36 +01:00 (CET) |
| Date last edited |
2025-11-26 10:02:31 +01:00 (CET) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|