Variant #0000822920 (NC_000008.10:g.87723573_87723574ins[ATGGTATACACGTGTATACAC;87624822_87723573], NC_000008.10(NM_019098.4):c.903+2021_903+2022ins[GTGTATACACGTGTATACCAT;339-17849_903+2021] (CNGB3))
Individual ID |
00391327 |
Chromosome |
8 |
Allele |
Parent #2 |
Affects function (as reported) |
Affects function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
pathogenic (recessive) |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.87723573_87723574ins[ATGGTATACACGTGTATACAC;87624822_87723573] |
DNA change (hg38) |
g.86688947_86688948ins[ATGGTATACACGTGTATACAC;86651991_86688947] |
Published as |
dup ex4-7 (g.86688947_86688948insMF045863.1 g.1_36978) |
ISCN |
- |
DB-ID |
CNGB3_000257 See all 3 reported entries |
Variant remarks |
- |
Reference |
PubMed: Mayer 2017 |
ClinVar ID |
SCV000575863 |
dbSNP ID |
- |
Origin |
Germline |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
Johan den Dunnen |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
Johan den Dunnen |
Date created |
2021-11-15 17:28:17 +01:00 (CET) |
Date last edited |
2021-11-18 16:18:14 +01:00 (CET) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|