Variant #0000847470 (NC_000009.11:g.?, NM_006415.2:c.? (SPTLC1))
| Individual ID |
00408940 |
| Chromosome |
9 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.? |
| DNA change (hg38) |
- |
| Published as |
c.?35delCCGCTTCCTTCCGGAAGGCGGGTCACAAG |
| ISCN |
- |
| DB-ID |
PTCH1_000000 See all 35 reported entries |
| Variant remarks |
- |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Genomic location of variant could not be determined |
| Owner |
LOVD |
| Database submission license |
Creative Commons Attribution 4.0 International |
| Created by |
Julia Lopez |
| Date created |
2022-04-29 01:04:01 +02:00 (CEST) |
| Date last edited |
N/A |
Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|