Variant #0000848855 (NC_000001.10:g.78392075_78392099del, NC_000001.10(NM_144573.3):c.490-24_490del (NEXN))
      
      
        
          | Chromosome | 
          1 |  
        
          | Allele | 
          Unknown |  
        
          | Affects function (as reported) | 
          Effect unknown |  
        
          | Affects function (by curator) | 
          Not classified |  
        
          | Classification method | 
          - |  
        
          | Clinical classification | 
          VUS |  
        
          | DNA change (genomic) (Relative to hg19 / GRCh37) | 
          g.78392075_78392099del |  
        
          | DNA change (hg38) | 
          - |  
        
          | Published as | 
          NEXN(NM_144573.4):c.490-25_490-1delGCTAATTATCTATTTTATAAAATAG |  
        
          | ISCN | 
          - |  
        
          | DB-ID | 
          NEXN_000112 |  
        
          | Variant remarks | 
          VKGL data sharing initiative Nederland |  
        
          | Reference | 
          - |  
        
          | ClinVar ID | 
          - |  
        
          | dbSNP ID | 
          - |  
        
          | Origin | 
          CLASSIFICATION record |  
        
          | Segregation | 
          - |  
        
          | Frequency | 
          - |  
        
          | Re-site | 
          - |  
        
          | VIP | 
          - |  
        
          | Methylation | 
          - |  
        
          | Average frequency (gnomAD v.2.1.1) | 
          Retrieve |  
        
          | Owner | 
          VKGL-NL_AMC |  
        
          | Database submission license | 
          Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International   |  
        
          | Created by | 
          VKGL-NL_AMC |  
        
          | Date created | 
          2022-05-09 15:40:45 +02:00 (CEST) |  
        
          | Date last edited | 
          2023-01-11 15:44:22 +01:00 (CET) |   
        
      
      
      
  
      
       
      
  
      Variant on transcripts
      
      
       
      
      
     | 
   
 
 
 
    Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
    Use our  APIs to retrieve data.
  
 |