Variant #0000849000 (NC_000002.11:g.1653157_1653179del, NM_012293.1:c.2375_2397del (PXDN))
| Chromosome |
2 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.1653157_1653179del |
| DNA change (hg38) |
- |
| Published as |
PXDN(NM_012293.3):c.2375_2397delTTCCCATGCCGCGCCTGGTGTCC (p.L792Hfs*67) |
| ISCN |
- |
| DB-ID |
PXDN_000002 See all 3 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_AMC |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_AMC |
| Date created |
2022-05-09 15:40:45 +02:00 (CEST) |
| Date last edited |
2023-01-11 15:44:22 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|