Variant #0000854131 (NC_000015.9:g.65943115_65943141del, NM_004727.2:c.2628_2654del (SLC24A1))

Chromosome 15
Allele Unknown
Affects function (as reported) Probably does not affect function
Affects function (by curator) Not classified
Classification method -
Clinical classification likely benign
DNA change (genomic) (Relative to hg19 / GRCh37) g.65943115_65943141del
DNA change (hg38) -
Published as SLC24A1(NM_004727.2):c.2628_2654delAGAGCAGGAGGAAGAGGAGGAGGAGGA (p.Q878_E886del)
ISCN -
DB-ID DENND4A_000031 See all 2 reported entries
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Origin CLASSIFICATION record
Segregation -
Frequency -
Re-site -
VIP -
Methylation -
Average frequency (gnomAD v.2.1.1) Retrieve
Owner VKGL-NL_Rotterdam
Database submission license Creative Commons Attribution-NonCommercial-ShareAlike 4.0 InternationalCreative Commons License
Created by VKGL-NL_Rotterdam
Date created 2022-05-09 15:47:41 +02:00 (CEST)
Date last edited N/A
Options




Variant on transcripts


Gene     

AscendingTranscript     

Affects function     

Exon     

DNA change (cDNA)     

RNA change     

Protein     
SLC24A1 NM_004727.2 -?/. - c.2628_2654del r.(?) p.(Gln878_Glu886del)
DENND4A NM_005848.3 -?/. - c.*11086_*11112del r.(=) p.(=)


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.