Variant #0000887480 (NC_000006.11:g.82461760_82461789del, NM_017633.2:c.102_131del (FAM46A))
| Chromosome |
6 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.82461760_82461789del |
| DNA change (hg38) |
- |
| Published as |
FAM46A(NM_017633.2):c.102_131del (p.(Asp36_Gly45del)), TENT5A(NM_017633.2):c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG (p.D36_G45del), TENT5A(NM_01...) |
| ISCN |
- |
| DB-ID |
FAM46A_000007 See all 3 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_VUmc |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_VUmc |
| Date created |
2022-11-01 13:01:21 +01:00 (CET) |
| Date last edited |
2023-11-27 17:27:23 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|