Variant #0000887481 (NC_000006.11:g.82461760_82461789dup, NM_017633.2:c.102_131dup (FAM46A))
| Chromosome |
6 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.82461760_82461789dup |
| DNA change (hg38) |
- |
| Published as |
FAM46A(NM_017633.2):c.87_116dupCGGCGACTTCGGCGGCGGCGACTTCGGCGG (p.(Gly39_Gly40insGlyAspPheGlyGlyGlyAspPheGlyGly)), TENT5A(NM_017633.3):c.72_101dupCG... |
| ISCN |
- |
| DB-ID |
FAM46A_000008 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_VUmc |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_VUmc |
| Date created |
2022-11-01 13:01:21 +01:00 (CET) |
| Date last edited |
2024-08-28 13:16:32 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|