Variant #0000890770 (NC_000012.11:g.7045891_7045917del, NM_001007026.1:c.1461_1487del (ATN1))
| Chromosome |
12 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.7045891_7045917del |
| DNA change (hg38) |
- |
| Published as |
ATN1(NM_001007026.2):c.1461_1487delACAGCAGCAGCAGCAGCAGCAGCAGCA (p.Q494_Q502del) |
| ISCN |
- |
| DB-ID |
ATN1_000149 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2022-11-01 13:01:21 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|