Variant #0000893959 (NC_000017.10:g.42429557_42429577del, NM_002087.2:c.1354_1374del (GRN))
| Chromosome |
17 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.42429557_42429577del |
| DNA change (hg38) |
- |
| Published as |
GRN(NM_002087.4):c.1354_1374delGTGGGGCAGACCTGCTGCCCG (p.V452_P458del) |
| ISCN |
- |
| DB-ID |
FAM171A2_000027 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2022-11-01 13:41:49 +01:00 (CET) |
| Date last edited |
2023-01-11 15:44:22 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|