Variant #0000899607 (NC_000001.10:g.94512522_94512542del, NM_000350.2:c.2857_2877del (ABCA4))
| Individual ID |
00422545 |
| Chromosome |
1 |
| Allele |
Parent #1 |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic (recessive) |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.94512522_94512542del |
| DNA change (hg38) |
g.94046966_94046986del |
| Published as |
2857_2877delTTCTACGAGAACCAGATCACC |
| ISCN |
- |
| DB-ID |
ABCA4_001113 See all 5 reported entries |
| Variant remarks |
- |
| Reference |
PubMed: Tian 2024 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
yes |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Lu Tian |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2022-11-10 17:26:36 +01:00 (CET) |
| Date last edited |
2023-10-26 11:19:13 +02:00 (CEST) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|