Variant #0000911013 (NC_000001.10:g.240370954_240370985del, NM_020066.4:c.2842_2873del (FMN2))
| Chromosome |
1 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.240370954_240370985del |
| DNA change (hg38) |
- |
| Published as |
FMN2(NM_020066.5):c.2842_2873delCTACCCGGAGCGGCAATACCCCCTCCGCCCCC (p.L948Sfs*294) |
| ISCN |
- |
| DB-ID |
FMN2_000106 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
0.00035 View details |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2023-01-11 15:44:22 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|