|   
  
    | Variant #0000913581 (NC_000011.9:g.45958032_45958052del, NC_000011.9(NM_001101802.1):c.1676_1681+15del (PHF21A))
        
          | Chromosome | 11 |  
          | Allele | Unknown |  
          | Affects function (as reported) | Affects function |  
          | Affects function (by curator) | Not classified |  
          | Classification method | - |  
          | Clinical classification | pathogenic |  
          | DNA change (genomic) (Relative to hg19 / GRCh37) | g.45958032_45958052del |  
          | DNA change (hg38) | - |  
          | Published as | PHF21A(NM_001352025.3):c.1679_1684+15delAAGCAGGTAAGGAGTTATCCA |  
          | ISCN | - |  
          | DB-ID | PHF21A_000032 |  
          | Variant remarks | VKGL data sharing initiative Nederland |  
          | Reference | - |  
          | ClinVar ID | - |  
          | dbSNP ID | - |  
          | Origin | CLASSIFICATION record |  
          | Segregation | - |  
          | Frequency | - |  
          | Re-site | - |  
          | VIP | - |  
          | Methylation | - |  
          | Average frequency (gnomAD v.2.1.1) | Retrieve |  
          | Owner | VKGL-NL_VUmc |  
          | Database submission license | Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International   |  
          | Created by | VKGL-NL_VUmc |  
          | Date created | 2023-01-11 15:44:22 +01:00 (CET) |  
          | Date last edited | N/A |   
 
 
 
       
 
 Variant on transcripts
 |  
 
    Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
    Use our APIs  to retrieve data.
 |