Variant #0000927322 (NC_000023.10:g.25031660_25031683del, NM_139058.2:c.441_464del (ARX))
| Chromosome |
X |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.25031660_25031683del |
| DNA change (hg38) |
- |
| Published as |
ARX(NM_139058.2):c.441_464del (p.(Ala148_Ala155del)), ARX(NM_139058.3):c.441_464delAGCCGCGGCCGCGGCCGCCGCGGC (p.A148_A155del) |
| ISCN |
- |
| DB-ID |
ARX_000041 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2023-04-16 21:50:28 +02:00 (CEST) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|